, 1997; Casjens et al., 2000). Although the B. burgdorferi chromosome is rather small (approximately one megabase), the complexity and large sizes of many of the plasmids (some larger than 50 kb) greatly expand the DNA coding capacity of this spirochete. At the same time, however, it is currently poorly understood what role surface proteins encoded by genes on the various plasmids contribute to virulence and/or disease pathogenesis. The data accumulated thus far overwhelmingly support the hypothesis that plasmid-encoded proteins

are important in Lyme disease pathogenesis Y-27632 cost and could encode antigens that are important virulence factors and/or potential vaccinogens for Lyme disease. Given that the first vaccine developed for Lyme disease was generated against the fairly well conserved, plasmid-encoded OspA, it seems likely that Crizotinib the identification of another outer surface protein that is well conserved throughout borrelial genospecies would be a viable candidate for a developing a new vaccine molecule. This review outlines the outer surface proteins that have been identified thus far in various borrelial species, although the main focus is on the type

strain B. burgdorferi strain B31. The outer surface proteins described below fall into two main categories, lipid-modified outer surface proteins that are anchored to the outer leaflet of the outer membrane through their lipid moieties (e.g. OspA, OspB, OspC, OspD, OspE, OspF, DbpA, DbpB, CspA, VlsE, BptA, and several others with no known function) and outer surface proteins that have one or more transmembrane domains that anchor them into the outer membrane (e.g. P13, P66, BesC, BamA, Lmp1, and BB0405). The sections following provide a detailed examination of what is currently known about outer surface lipoproteins and membrane-spanning OMPs of B. burgdorferi. The B. burgdorferi genome Amino acid encodes several lipoproteins that are localized to the surface of B. burgdorferi (Fraser et al., 1997; Casjens

et al., 2000). The surface lipoproteins of B. burgdorferi are now well recognized as important virulence determinants. As mentioned previously, because of the extracellular nature of this pathogen, surface lipoproteins play an important role in virulence, host–pathogen interactions, and in maintaining the enzootic cycle of B. burgdorferi. Several borrelial surface lipoproteins have been identified that bind host proteins and promote the adherence to host cells. For instance, B. burgdorferi lipoproteins bind host glycosaminoglycans (GAGs), decorin, and fibronectin. Furthermore, lipoproteins have been implicated in evasion of the host immune response through antigenic variation and evasion of complement deposition.

These cells could, in turn, recruit neutrophils. Because livers of ALD patients, particularly those with AH, are infiltrated by IL-17+ cells [20], and because Th-17 cells play a role in neutrophil recruitment and express

CCR2 [22], we correlated CCL2 liver expression with IL-17+ cell infiltrates. We found that CCL2 liver expression was correlated with numbers of IL-17+ cells. Furthermore, IL-17+ cell infiltrates were correlated strongly with neutrophil infiltrates and with IL-8 liver expression. These results suggest that CCL2 plays a role in the pathogenesis of ALD by recruitment of Th17 cells which, in turn, would recruit neutrophils via an IL-8 effect. Dabrafenib nmr However, IL-17+ cell infiltrates may, in part, reflect neutrophil infiltrates. Indeed, we have shown previously, using confocal microscopy, that among liver-infiltrating IL-17+, T lymphocytes and neutrophils were represented most frequently [20]. As each AH episode is thought to be profibrogenic [4], we speculate that CCL2 secreted during the AH inflammatory burden

could enhance the fibrogenesis process. However, we found no difference in liver CCL2 expression between ALD patients with and without cirrhosis; nevertheless, this result should be viewed with caution, as non-cirrhotic patients in our cohort were scarce. We found no correlation between CCL2 liver expression and hepatic steatosis in our patient cohort, whereas CCL2 was involved in hepatic lipid metabolism in an experimental model of alcoholic liver disease Olaparib [16]. This relationship between CCL2 liver expression and steatosis may be present in the beginning of ALD, Guanylate cyclase 2C but not in severe disease such as cirrhosis. Patients with the G-allele for −2518 A > G CCL2 polymorphism were present more frequently in the severely ill AH group than in other ALD patients. Moreover, among AH patients, the G-allele was more frequent in the severe form of the disease. It was shown previously

that the presence of the −2518 G-allele resulted in significantly greater CCL2 secretion than that found in patients with the A/A homozygous genotype in response to a given inflammatory stimulus [23], and this polymorphism has been implicated in numerous inflammatory diseases, including hepatitis C, acute pancreatitis, Crohn’s disease and, more recently, spontaneous bacterial peritonitis [24,25,28,29]. However, we did not find higher CCL2 plasma levels or liver expression in G-allele carriers in our cohort of patients (data not shown). It is possible that G-allele carriers are more likely to develop a severe form of AH, but that the levels of CCL2 at the time of alcoholic hepatitis are the same as in G-non-carriers. Our finding suggests that G-allele carriers are more likely to develop a severe form of AH than patients without the G-allele when exposed to alcohol.

The frequencies of HBc 18-27-specific IFN-γ-producing CD8+ T cells were quantified by an ELISPOT assay using PBMC after 24-h period of stimulation with HBc 18-27 peptides according to the manufacturer’s instructions (Dakewe Biotech Com., Shenzhen, China). Briefly, the 96-well plate was coated with 5 μg/ml mouse anti-human IFN-γ monoclonal antibody

overnight at 4 °C, followed by six washes with sterile PBS, and freshly isolated PBMCs (2 × 105 cells) were added into the wells and incubated in 5% CO2 at 37 °C for 24 h in supplemented minimal essential medium with HBc 18-27 peptides (FLPSDFFPSV 10 μg/ml) or PMA/ionomycin (Alexis Biomol, San Diego, CA, USA) as a positive control. Cells in culture medium with HCV core 132–140 peptides (DLMGYIPLV) (SBS Genetech Co., Ltd.) were used as negative controls. Followed by removing the medium and cells and incubating with 200 μl deionized water on ice for 10 min, Selleck 5-Fluoracil plates Venetoclax in vivo were washed ten times with PBS containing 0.05% Tween-20, and then, 100 μl biotinylated secondary anti-human IFN-γ monoclonal antibody was added into cells and incubated at 37 °C for 1 h. After washing, the plates were incubated with HRP-labelled streptavidin at 37 °C for 1 h. Plates were then washed again, and AEC solution (100 μl/well)

was then added and incubated for 30 min at room temperature. The colour reaction was stopped by washing with distilled water. Plates were air-dried, and spots were counted with an automated ELISPOT reader (Cellular Technology Ltd., Shaker Heights, OH, USA). Each spot represented an IFN-γ-producing cell. The number of specific spot-forming cell (SFC) per 1 × 106 PBMC was determined as the

mean number of spots in the presence of HBcAg 18-27 peptides minus the mean number of spots in the wells with medium only. ELISPOT response was defined as positive when the ratio of SFC with versus without antigen was higher than 2.5. The fresh PBMCs from AHB patients were CD8+ T cell-deleted by magnetic cell sorting (MACS) (CD8+ T cell isolation kits, Miltenyi Biotec). At the same time, CD8+ T cells and CD4+ T cells were deleted from partial PBMCs by MACS (CD4+ T cell and CD8+ T cell isolation kits, Miltenyi Biotec). The CD8 T cell-deleted PBMCs or CD4-CD8 T cell-deleted PBMCs were rested or stimulated with rHBcAg (2 μg/ml; Kitgen) for 5 h at 37 °C. Leukotriene-A4 hydrolase After washed twice with PBS, 1 × 106 cells were plated in the bottom chambers of transwell plates. CD8+ T cells from PBMCs of IA patients were isolated using microbeads according to the manufacturer’s instructions (Miltenyi Biotech). 3 × 105 CD8+ T cells were placed in the upper chambers. Unpulsed CD8 T cell-depleted PBMCs in the bottom chamber with isolated CD8+ T cells in the upper chamber served as a negative control. Cells were cocultured with medium alone or anti-IL-21 neutralizing antibodies (10 μg/ml, ReliaTech, Germany, CA 102-P236) or IL-21 (10 ng/ml; Peprotech) for 12 h at 37 °C, 5% CO2.

90 Caspase inhibitor A major component of IFN-α/β-driven antiviral properties is the marked induction of

genes involved in antigen processing and presentation, particularly expression of class I genes and associated endocytic proteins involved in proteolysis and peptide loading. By engaging this pathway in an in vivo model of antigen cross-priming, Tough and colleagues91,92 demonstrated that IFN-α/β enhanced CD8+ T-cell expansion as well as cytolytic activity, which may explain the strong adjuvant effect of IFN-α/β on protein vaccination strategies. While the individual roles of IL-12 and IFN-α/β can be assessed in isolation in vitro, in vivo studies have revealed unique roles for IFN-α/β and IL-12 that depend upon priming conditions and the class of pathogen. Initial studies demonstrated that

the induction of IFN-α/β by CpG stimulation led to antigen-presenting cell-dependent T-cell proliferation, which required IFN-α/β signalling within the responding T cells.93 These early studies did not directly compare IFN-α/β with the powerful inflammatory effects of IL-12. However, comparing primary CD8+ responses with various pathogens, Murali-Krishna and colleagues94 demonstrated that IFN-α/β signals were required for CD8+ expansion in response to lymphocytic choriomeningitis virus (LCMV), but less so in response to vaccinia virus or Listeria monocytogenes infections.44 Based on this observation, it was postulated that antigenic load may contribute to CD8+ dependence on IFN-α/β for full expansion, as LCMV viral titres are much GSK 3 inhibitor higher during the peak of the infection than vaccinia virus titres. Furthermore, a recent study demonstrated GNAT2 that CD8+ responses to Trypanosoma cruzi were completely independent of IFN-α/β signalling.95 This is somewhat surprising given the dependence on IFN-α/β during cross-priming reported by Tough and colleagues. Nonetheless, all of these reports highlight the potential for IL-12 and IFN-α/β to significantly regulate CD8+ effector

responses, which were originally reported to be IL-12- and STAT4-independent. Interleukin-12 and IFN-α/β may also play distinct roles in regulating CD8+ T-cell memory development. First, although IL-12 has been reported to play a positive role in generating CD8+ effector cells, it seems to have an inverse role in generating memory cells. Pearce et al.96 recently demonstrated that the kinetics and magnitude of the CD8+ memory response to L. monocytogenes were significantly enhanced in IL-12Rβ2−/− cells. This observation correlated with enhanced CD8+ memory in T-bet knockout mice, as IL-12 has been reported to positively regulate T-bet expression.97,98 Moreover, as cells expand in response to antigen stimulation, the enhanced expression of T-bet driven by IL-12 generates populations of terminally differentiated cytotoxic effector cells.

An I.M.A.G.E. clone

(#4039129; accession BC055920) containing the cDNA encoding murine PIK3IP1 was obtained from Open Biosystems (Huntsville, AL, USA). The coding sequence was amplified by PCR with Pfu proofreading polymerase, using primers containing BamH1 (forward primer: TCGGATTCGCCACCATGCTGTTGGCTTGGGTACAC) MI-503 in vitro or XbaI (reverse primer: ATTCTAGAAGCTCCAGGGGTGCCAGCCTG) restriction sites. The resulting product was digested with BamHI and XbaI and ligated into the mammalian expression vector pEF1MycHisA (Invitrogen), resulting in the addition of C-terminal Myc and 6His tags to the PIK3IP1 sequence. The amplified sequence was verified by automated sequencing. BioGPS (http://biogps.gnf.org) or the Immunological Staurosporine chemical structure Genome Project (www.immgen.org) was searched using the keyword “pik3ip1.” Results from the former, shown in Fig. 1, represent expression of human PIK3IP1 message across a wide range of tissues and cell types, while data from the latter (not shown) confirmed expression of murine PIK3IP1 in T cells.

Jurkat and D10 T cells were transfected by electroporation. Cells in 400 μl total volume were pulsed at 250V (D10) or 260V (Jurkat), 950 μF, with exponential decay. For ectopic expression, cells were transfected with 15-μg luciferase reporter and the indicated concentrations of expression plasmids. Eighteen hours after transfection, cells were either lysed for western blot analysis or stimulated for 6 h, followed by determination of luciferase activity. For siRNA knock-down, cells were transfected with 15 μg of luciferase reporter and the indicated amounts of siRNA. Forty-two hours after transfection,

cells were stimulated for either 15 min (for phospho-Akt analysis) or for 6 h (for luciferase), as indicated. Microplate luciferase assays and western blotting were performed as described previously [15]. Jurkat Urocanase T cells were transfected with siRNA specific for PIK3IP1. After 48 h, cells were stimulated for 24 h with anti-TCR/CD28 antibodies. Cell-free supernatants were analyzed by ELISA for human IL-2, using OptEIA matched antibodies (BD Bioscience, San Diego, CA, USA). We thank S. Gaffen and members of the Kane lab for helpful discussions and for critical reading of the manuscript. This work was supported by NIH grants GM080398 (to L.P.K.) and CA105242 (to M.C.D.). The authors declare no financial or commercial conflict of interest. Disclaimer: Supplementary materials have been peer-reviewed but not copyedited. Supporting Information Figure 1: Duplicate experiment showing increased Akt S473 phosphorylation after PIK3IP1 knock-down. Control and knock-down panels are from the same western blot, with the same exposure. See Fig. 3 of the main text for more detail. Supporting Information Figure 2: Effects of PIK3IP1 knockdown on cytokine message and protein in a mouse T cell line.

It was somewhat surprising to us that CD4+ T cells derived from both nonhealing (La) and self-healing (Lb) models displayed comparable TCR diversity in either draining LN- or lesion-derived CD4+ T cells (Figure 1). Furthermore, we found that the production of IFN-γ appeared to be evenly contributed by multiple rather this website than one or two dominant Vβ+ CD4+ T cells during La or Lb infection, which is different from the report with the dominant IL-4 production by Vβ4+ CD4+ T cells in L. major infection (20). Of note, the relative contribution of individual

Vβ cells to the total IFN-γ production appeared comparable between La and Lb infection (Figure 2). Therefore, IFN-γ-producing CD4+ T cells in Leishmania infection are not directly related to TCR Vβ

diversity. The TCR diversity-related studies are well advanced in viral and bacterial infection in mouse models and humans. For example, several reports have shown the conserved TCR repertoire expansion in primary and memory CD8+ T-cell responses to lymphocytic choriomeningitis virus or influenza virus epitopes in mice (23,28). With regard to murine infection with intracellular bacteria Listeria monocytogenes, although the narrowed ‘private’ TCR Vβ repertoire was found within rechallenged individual mice, the antigen-specific T cells detected by a tetramer-based Cilomilast approach revealed a relatively diverse TCR Vβ repertoire in primary and memory CD8+ T-cell populations (29,30). Likewise, diverse TCR Vβ usages in CD4+ and Buspirone HCl CD8+ T cells were reported during pulmonary Cryptococcus neoformans infection in mice (31). Because protozoan parasites contain relatively large genome sizes and complex protein profiles

but replicate relatively slow in vivo, our findings of a diverse rather than focused TCR Vβ repertoire in FACS analyses of CD4+ T cells during Leishmania infection may not be surprising. The potential concerns of this FACS-based approach include its biological relevance and detection limit. We took two approaches to address these issues. First, we performed detailed analyses for IFN-γ production among several major Vβ subsets (Vβ4, 6 and 8) and a minor Vβ subset (Vβ7). The interesting findings are (1) in comparison with La infection counterparts, Lb infection showed higher percentages of IFN-γ-producing cells in each of the tested individual TCR Vβ subsets in primary (Figure 2) and secondary infection (Figures 3 and 4) and (2) for a given Vβ subset, its relative contribution to IFN-γ production appeared comparable in La versus Lb infection, judged by the percentages of IFN-γ+ cells within its Vβ+ cells. These functional analyses again suggest a diverse rather than focused TCR Vβ repertoire in Leishmania infection. Second, we examined the CDR3 region of individual TCR Vβ by PCR- and gel-based techniques, because PCR-based spectratyping is a powerful tool to analyse the sizes of TCR CDR3 regions of the oligoclonal expansion of T cells (16–18).

3). In addition, the detection limit is very low. With only two DNA copies, it has a higher sensitivity than the currently applied molecular methods, such as semi-nested PCR BI 6727 in vivo (10 pg) (Prariyachatigul et al., 2003), PCR enzyme immunoassay (3.2 pg) (Lindsley et al., 2001), PCR hybridization (0.1 pg) (Vanittanakom et

al., 1998) and nested PCR (0.07 pg) (Zeng et al., 2009). The results of P. marneffei detection by LAMP in 23 paraffin wax-embedded clinical samples and 11 bamboo rat tissues were also highly specific. The etiologic agents of the 23 clinical samples were verified previously using culture and sequencing data. Twelve samples were histopathologically positive; all molecular identifications matched with the clinical diagnoses. Samples from penicilliosis and from the natural bamboo rat host were positive with LAMP, whereas all others, including healthy human skin, proved to be negative. Test results were not inhibited by nontarget

DNA. This makes the LAMP technique highly promising for evaluation and application in problematic clinical Target Selective Inhibitor Library ic50 samples such as blood, urine and sputum. In this study, we have proved with the example of P. marneffei that LAMP is a very efficient method for the quick and sensitive identification of fungal pathogens and opportunists. The method can be applied not only to cultures but also to a variety of clinical samples. This can be of great significance to organisms that cause invasive or disseminated infections that are difficult to cultivate from such samples, such as the zygomycete species. A further application may be for detection without isolation of the fungi in the environment. In summary, in the current study, we proved that the LAMP technique enables specific detection of P. marneffei and excludes related biverticillate penicillia and Talaromyces teleomorphs. Similar results were obtained in Paracoccidioides (Endo et al., 2004), Candida (Inacio et al., 2008) and Ochroconis (Ohori et al., 2006). However, in Fonsecaea, identification was possible only at the generic level (Najafzadeh, 2009). An explanation for this phenomenon may be found in the fact that

Penicillium species are relatively distant from each other, with ITS barcoding gaps well over 1%, whereas in Fonsecaea ITS, interspecific these differences are a few bases only, species delimitations being based on multilocus analyses. We thank Prof. Yokoyama (Center for Pathogenic Fungi and Microbial Toxicoses Chiba University, Chiba, Japan) for providing the reference strains taxonomically close to P. marneffei included in this paper. This study was supported partly by a grant (30770121/2007) from the National Natural Science Foundation of China. “
“Human parturition is associated with an intrauterine pro-inflammatory environment in the choriodecidua. Evidence that some mediators of this signaling cascade also elicit responses leading to labor prompted us to characterize the cellular sources of these mediators in the human choriodecidua.

The effect of perioperative transfusion of old RBCs on postoperative complications after free muscle sparing transverse rectus abdominis myocutaneous (TRAM) flap surgery was retrospectively

investigated. Two hundred sixty-one patients undergoing breast reconstruction were assigned to two groups: no transfusion and transfusion groups. Transfused patients were further divided according to the RBC storage duration (fresh, ≤14 days; old, >14 days). Postoperative complications such as vascular selleck inhibitor thrombosis, hematoma, and flap congestion were noted. Patients who received old blood (n = 34), compared with those received fresh blood (n = 40) or no transfusion (n = 187), had a higher incidence of postoperative complications (44.1% vs. 20.0% or 12.8%, P < 0.05). Perioperative transfusion of old RBCs can be associated with an increase in postoperative complications after free muscle sparing TRAM flap surgery. © 2014 Wiley Periodicals, Inc. Microsurgery 34:434–438, 2014. "
“Lower abdominal, perineal, and Y-27632 purchase groin (LAPG) reconstruction may be performed in a single stage. Anterolateral thigh (ALT) flaps are preferred here and taken as fasciocutaneous (ALT-FC), myocutaneous (ALT-MC), or vastus lateralis myocutaneous (VL-MC) flaps. We aim to present the results of reconstruction from a series of patients and guide flap selection with an algorithmic approach

to LAPG reconstruction that optimizes outcomes and minimizes morbidity. Lower abdomen, groin, perineum, vulva, vagina, scrotum,

and bladder wounds reconstructed in 22 patients using ALT flaps between 2000 and 2013 were retrospectively studied. Five ALT-FC, eight ALT-MC, and nine VL-MC flaps were performed. All flaps survived. Venous congestion occurred in three VL-MC flaps from mechanical cause. Wound infection occurred in six cases. Urinary leak occurred in three cases of bladder reconstruction. One patient died from congestive heart failure. The ALT flap is time tested and dependably addresses most LAPG defects; flap variations are suited for niche defects. We propose a novel algorithm to guide reconstructive decision-making. Inositol monophosphatase 1 © 2014 Wiley Periodicals, Inc. Microsurgery, 2014. “
“Introduction. As peripheral nerve specialists can have a wide variety of training backgrounds, few standards of care exist with respect to necessary incision length, amount of dissection, and operative technique for common nerve decompressions. Methods. Approaches for the following 12 common peripheral nerve surgeries were minimized using shorter incisions and a simple lighted retractor: zygomatico-temporal and auriculotemporal, greater occipital, brachial plexus, ulnar, radial, median, lateral femoral cutaneous nerve of the thigh, peroneal at the groin, fibular neck and lateral calf, and tibial and inner ankle. The new “minimal” incision length was recorded as was that of the “classical” approach as taught to the senior author and frequently represented in atlases.

Late referral is associated with increased mortality on ESKD treatment and is more common in disadvantaged areas. Among indigenous ESKD patients, a poor understanding of their own CKD has been linked to non-compliance and reduced active involvement

in their own management.28 Reduced engagement with care providers and services is a risk factor for poor outcomes with CKD care. Databases searched: The search strategies were designed to reduce bias and ensure that most of the relevant data available on type 2 diabetes were included in the present review and were similar to those detailed in the Cochrane Collaboration Reviews Handbook (Higgins JPT et al.).29 The electronic databases searched were Medline, EMBASE, Cochrane Library, CINAHL, HTA and DARE. The detailed search strategy, research terms and yields are provided in Appendix 3 of the complete guideline document that can be found 5-Fluoracil nmr on the CARI website (http://www.cari.org.au). Date of searches: Cost-effectiveness

– 1 August 2008. Socioeconomic implications – 5 January 2009. Screening people with type 2 diabetes for microalbuminuria and intensive treatment of those with elevated BP with ACEi and ARB antihypertensive agents is supported by cost-effectiveness studies. The cost-effectiveness of intensive Opaganib cost BP control in people with type 2 diabetes, elevated BP and normoalbuminuria, has been evaluated in the UKPDS over a mean interval of 8.8 years.30

The intensive BP control group (n = 758) DCLK1 achieved a mean arterial pressure of 103 mmHg (144/82 mmHg) compared with 109 mmHg (154/87 mmHg) in the usual treatment group (n = 390). Use of resources driven by trial protocol and in standard clinical practice were compared. The main outcome measures were, firstly, cost-effectiveness ratios calculated from use of healthcare resources and, secondly, within-trial time free from diabetes-related endpoints and projected estimates of life years gained. Compared with use of resources in standard clinical practice intensive BP control was associated with an incidental cost of £1049 per extra year free from end points (costs and effects discounted at 6% per year). When the analysis was extended to life expectancy, the incremental cost per life year gained was £720, using the same discounting procedures. This UKPDS analysis represents the first evidence suggesting that tight control of BP for hypertensive people with type 2 diabetes offers a cost-effective means of reducing the risk of complication and improving health.30 In a further analysis of the UKPDS study, Gray performed an evaluation of the cost-effectiveness of intensive blood pressure control with atenolol (n = 358) vs captopril (n = 758).31 There was no significant difference in life expectancy between groups.

We saw no significant decline in PUFA levels related to immunization or challenge in the DTH model, except for arachidonic acid in the control group, even though footpad swelling in individual animals

correlated positively with reductions in serum EPA levels during the challenge phase. Evidently, the Th1-mediated inflammation did not consume the same amounts of fatty acids as the Th2-mediated inflammation. This could be explained by the difference in the size of the organs assessed in the two models – paws in the DTH model compared with the entire respiratory system in the airway model. Another possibility is that Th2-driven inflammation consumes large amounts of fatty acids because eosinophils are versatile producers of products from unsaturated fatty acids [24]. Further, we observed a reduction of selleck PUFA levels concomitant with immunization with a Th2-promoting adjuvant (alum), but not alongside selleckchem immunization with a Th1-promoting adjuvant (Freund’s complete adjuvant). Th1 immunity was actually accomplished by an increase in serum arachidonic acid and DHA levels after immunization. The consumption of PUFAs during the Th2- but not the Th1-sensitization phase opens

the possibility that lipid mediators formed from PUFAs participate in producing the outcome of the interaction between the antigen-presenting cell and the naive T cell, in a way leading to Th2 cell maturation. The mechanisms can only be speculated upon and need further investigation. PUFAs affect gene transcription factors [25], production of prostaglandins and related mediators and affect thrombocyte activation and coagulation, processes that are linked intimately to inflammation ID-8 and immunity [26]. In conclusion, our results demonstrate clearly the complexity of the immunomodulatory effects of PUFAs and point to the importance of a clear definition of the type of immune reaction involved before testing PUFA supplementation as a preventive or disease-modulatory treatment. PUFA supplementation could probably be of significance to patients suffering from Th1-mediated

food allergies. However, at present we cannot draw conclusions concerning effects of PUFA supplementation on patients suffering from allergies that are complex mixtures of Th1 and Th2 immune reactions. This work was supported by the Swedish Research Council for Environmental, Agricultural Sciences and Spatial Planning (FORMAS), Food and Health Concept Center, Swedish Nutrition Foundation and Swedish Research Council, Gothenburg, Sweden. The authors declare no financial or commercial conflicts of interest. “
“Department of Clinical Research, Hamdard University, New Delhi, India In T-cell-mediated autoimmune diseases of the CNS, apoptosis of Fas+ T cells by FasL contributes to resolution of disease. However, the apoptosis-inducing cell population still remains to be identified.