These 2 parallel approaches provide complementary insights into the complexity and heterogeneity of migraine. “
“Background.— US Headache Consortium Guidelines state that persons with migraine with headache-related disability

should receive certain acute treatments Birinapant concentration including migraine-specific and other medications. However, many eligible individuals do not receive these therapies. Individuals with migraine may experience barriers to receiving minimal appropriate care. We aimed to identify barriers to care in a population sample of individuals with episodic migraine. We assessed barriers at 3 levels: medical consultation, diagnosis, and acute pharmacologic therapy use and assessed the contribution of socioeconomic, demographic, and headache-specific variables to these barriers. Methods.— We identified 3 steps that were minimally necessary to achieve guideline-defined appropriate acute pharmacologic therapy as: (1) consulting a prescribing health care professional; (2) receiving a migraine diagnosis; and (3) using migraine-specific or other appropriate acute treatments. We used data from the 2009 American Migraine

Prevalence and Prevention study sample to identify persons with episodic migraine with unmet treatment needs, defined by a Migraine Disability Assessment Scale (MIDAS) score corresponding to Grade II (mild), III (moderate), or IV (severe) headache-related disability. We determined whether these individuals had consulted a health care professional for headache over the previous year, if they ever received a medical

diagnosis of migraine from a health care professional, and VX-809 manufacturer whether they were currently using appropriate acute treatment for migraine (ie, a triptan, prescription non-steroidal anti-inflammatory drug, or an isometheptene-containing agent). We analyzed several socioeconomic, demographic, and headache-specific variables to determine if they were related to barriers in any of the 3 defined steps. Results.— Of 775 eligible participants with episodic migraine and headache-related disability, 45.5% (n = 353/775) had consulted health care professional MCE公司 for headache in the preceding year. Among those individuals, 86.7% (n = 306/353) reported receiving a medical diagnosis of migraine. Among the diagnosed consulters, 66.7% (204/306) currently used acute migraine-specific treatments. Only 204 (26.3%) individuals successfully completed all 3 steps. Multivariate logistic regression models revealed that the strongest predictors of current consulting for headache were having health insurance odds ratio (OR) = 1.73 (95% confidence interval [CI], 1.07-2.79), high headache-related disability (OR = 1.06 [95% CI, 1.0-1.14] for a 10-point change in MIDAS score), and a high composite migraine symptom severity score (OR = 1.19 [95% CI, 1.05-1.36]). Among consulters, diagnosis was much more likely in women than men (OR = 4.25 [95% CI, 1.61-11.

[119] Supported but self-directed pain management focused around lifestyle change and reducing the impact of pain on quality of life is a more effective management approach in chronic pain than the traditional, didactic biomedical model, but these strategies need to be tailored

appropriately.[120] Orofacial pain in its fullest definition affects up to a quarter of the population, and the associated morbidity, social impact, and health costs can be high if these conditions are not accurately diagnosed and managed in a timely fashion. Recognition of the significant contribution and high prevalence FK506 ic50 of psychological distress and comorbidity is essential for successful management. Multidisciplinary approaches and a biopsychosocial model of pain management are an essential adjunct to established evidence-based medical and surgical management of these conditions. JZ undertook this work at UCL/UCLHT, who received a proportion of funding from the Department Acalabrutinib supplier of Health’s NIHR Biomedical Research Centre funding scheme. (a)  Conception and Design (a)  Drafting the Manuscript (a)  Final Approval of the Completed Manuscript “
“Greater occipital nerve (GON) infiltration

is widely used for the treatment of primary and secondary headache disorders mainly on the basis of open-label evidence, although recent double-blinded placebo-controlled trials have demonstrated its efficacy in cluster headache. The procedure is generally well tolerated although corticosteroid-related side effects, including Cushing’s syndrome and local cutaneous changes, can occur.

We report the occurrence of cutaneous atrophy and alopecia in 4 patients who underwent GON blockade with triamcinolone and lidocaine. Triamcinolone injection is associated with cutaneous atrophy, especially in superficial injection sites; therefore, alternative steroid preparations like methylprednisolone and betamethasone might be more appropriate for GON blockade. “
“Objective.— MCE公司 One goal of the campaign “Lifting the burden: The global campaign against headache” is to highlight existing evidence about headache worldwide. In this context, the aim of our study was to report the migraine-related headache burden in northern Tanzania. Methods.— From December 2003 until June 2004 a community-based door-to-door survey was undertaken in northern Tanzania, using multistage cluster sampling. Based on the criteria of the International Headache Society, 7412 individuals were enrolled in this survey. Results.— Migraine patients’ average annual attack frequency was 18.4 (n = 308, standard deviation [SD] ± 47.4) with a mean duration of 16.4 hours (SD ± 20.6). The average headache intensity per patient was 2.65 (SD ± 0.59) with a calculated loss of 6.59 (SD ± 26.7) working days per year. Extrapolation of data to the investigated population (n = 7412) resulted in annual migraine burden of 281.0 migraine days per 1000 inhabitants. Conclusions.

[119] Supported but self-directed pain management focused around lifestyle change and reducing the impact of pain on quality of life is a more effective management approach in chronic pain than the traditional, didactic biomedical model, but these strategies need to be tailored

appropriately.[120] Orofacial pain in its fullest definition affects up to a quarter of the population, and the associated morbidity, social impact, and health costs can be high if these conditions are not accurately diagnosed and managed in a timely fashion. Recognition of the significant contribution and high prevalence Wnt inhibitor of psychological distress and comorbidity is essential for successful management. Multidisciplinary approaches and a biopsychosocial model of pain management are an essential adjunct to established evidence-based medical and surgical management of these conditions. JZ undertook this work at UCL/UCLHT, who received a proportion of funding from the Department H 89 cell line of Health’s NIHR Biomedical Research Centre funding scheme. (a)  Conception and Design (a)  Drafting the Manuscript (a)  Final Approval of the Completed Manuscript “
“Greater occipital nerve (GON) infiltration

is widely used for the treatment of primary and secondary headache disorders mainly on the basis of open-label evidence, although recent double-blinded placebo-controlled trials have demonstrated its efficacy in cluster headache. The procedure is generally well tolerated although corticosteroid-related side effects, including Cushing’s syndrome and local cutaneous changes, can occur.

We report the occurrence of cutaneous atrophy and alopecia in 4 patients who underwent GON blockade with triamcinolone and lidocaine. Triamcinolone injection is associated with cutaneous atrophy, especially in superficial injection sites; therefore, alternative steroid preparations like methylprednisolone and betamethasone might be more appropriate for GON blockade. “
“Objective.— MCE公司 One goal of the campaign “Lifting the burden: The global campaign against headache” is to highlight existing evidence about headache worldwide. In this context, the aim of our study was to report the migraine-related headache burden in northern Tanzania. Methods.— From December 2003 until June 2004 a community-based door-to-door survey was undertaken in northern Tanzania, using multistage cluster sampling. Based on the criteria of the International Headache Society, 7412 individuals were enrolled in this survey. Results.— Migraine patients’ average annual attack frequency was 18.4 (n = 308, standard deviation [SD] ± 47.4) with a mean duration of 16.4 hours (SD ± 20.6). The average headache intensity per patient was 2.65 (SD ± 0.59) with a calculated loss of 6.59 (SD ± 26.7) working days per year. Extrapolation of data to the investigated population (n = 7412) resulted in annual migraine burden of 281.0 migraine days per 1000 inhabitants. Conclusions.

Our recent PCI-32765 cost study found that the most abundant isoform Txl-2b in colon cancer stimulated cancer cell metastasis. However, the role of Txl-2b in tumor growth was still unknown. Methods: In this study, the function of Txl-2b on cell proliferation and apoptosis were investigated, accompanied with the downstream signaling. Results: Inhibition of Txl-2b led to the suppression of proliferation, cell

cycle arrest at the G1/S phase of the cell cycle, and induction of 5-fluorouracil-induced apoptosis in SW620 cells, whereas overexpression of Txl-2b in LoVo cells led to the opposite effect. In vivo study validated that Txl-2b may promote colon cancer tumorigenesis in nude mice. Further studies revealed that the nuclear factor-κB (NF-κB) signal was activated by Txl-2b through a redox-dependent manner. SN50, a specific inhibitor of NF-κB, partly abrogated the in vitro phenotypes of cell proliferation and resistance of apoptosis induced by Txl-2b through reduced expression of Bcl-2, as well as increased expression of Bax and caspase-3 and -7 activation. Conclusion: Overall, the present study indicates that Txl-2b

stimulates cancer cell proliferation, accelerates cell cycle and contributes to resistance of apoptosis in colon cancer and provides a potential therapeutic target for the treatment of colon cancer. Key Word(s): 1. colon cancer; 2. proliferation; 3. apoptosis; 4. thioredoxin-like 2; Presenting Author: LIANG YU FEI Additional Authors: ZHENG GUO QI, WEI SI CHEN, SONG HUI, YANG YU XIN, YIN WEN JIE, ZHANG XIU GANG Corresponding Author: ZHENG GUO QI Affiliations: hebei medical univercity Objective: To explore the clinical see more features of localized peritoneal mesothelioma by the analysis of the clinical data

of them and asbestos exposure relationship in our hospital. Methods: We collected clinical information of patients with pathologically confirmed localized peritoneal mesothelioma 上海皓元医药股份有限公司 in our hospital for the past six years, to analyze the incidence, asbestos exposure history, clinical manifestations, imaging studies, histological type and tumor markers of peritoneal malignant mesotheliom patients. Results: 189 cases of patients with PMM were treated in our hospital, including 22 cases of localized peritoneal mesothelioma which accounting for 11.64%. In 22 cases, 63.63% had history of asbestos exposure, and women accounted for 68.18%. The onset of symptoms to treatment time was from 2 days to 1 year, with an average of 83 days. Clinical symptoms were vary including localized abdominal pain, abdominal distension and abdominal mass. Local peritoneal mass or local inflammation was more common by abdominal CT, In addition, some patients with ascites. Epithelial type was the main athological type. Ultrasound-guided peritoneal biopsy was confirmed as the main diagnostic method followed by Laparotomy. Platelet and CA125 were increased.

We found that, like hio embryos, WT medaka embryos that had been injected with wnt2bb-MO lacked prox1 expression (Fig. 5B). These results suggest that Wnt2bb signaling is responsible for liver specification in medaka. In conclusion, our study has shown that the hio mutation in medaka impairs liver specification by abrogating wnt2bb expression. Our data are thus the first

genetic evidence that RA signaling positively regulates liver specification by inducing wnt2bb expression. In this study, we examined the role of RA signaling during embryogenesis by characterizing medaka hio mutants. These mutants bear Alectinib chemical structure an alteration to the raldh2 gene (Fig. 1) that encodes the enzyme principally responsible for RA synthesis, and we interpret that this is a nearly null mutation because the phenotypes of hio mutant are similar to that of RALDH2 morphants (Fig. 2 and

Supporting Fig. 1). MI-503 The hio mutants exhibit two prominent phenotypes: missing pectoral fins and a small liver (Fig. 2 and Supporting Fig. 1). Work in mouse, chick, and zebrafish has shown that RA signaling from the somitic mesoderm is essential for limb induction and is mediated by the expression of downstream factors such as wnt2ba and tbx5.7–14 We show that the hio mutation in medaka leads to defects in pectoral fin development and tbx5 and wnt2ba expression (Supporting Fig. 2). Thus, our results indicate that RA signaling is crucial for fin specification in medaka and show that limb induction MCE signaling is conserved across a broad range of species (Fig. 6, right part). Significantly, our work has also uncovered a role for RA signaling in liver development. We have demonstrated that the hio mutation retards the formation of hepatic buds from the foregut (Fig. 3A) and causes a profound defect in liver specification (Fig. 3B). In addition, we

have shown that the wnt2bb expression required for the regulation of liver specification is undetectable in the LPM of hio embryos (Fig. 5A). Our data constitute the first genetic evidence that RA signaling regulates vertebrate liver specification by inducing wnt2bb gene expression (Fig. 6, left part). Previously, Wang et al.23 reported that liver growth is severely affected in RALDH2-deficient mouse embryos. Thus, RA signaling in liver specification may be conserved among other species. There are several similarities in the signaling pathways governing pectoral fin and liver organogenesis. During zebrafish pectoral fin development, RA signaling induces wnt2ba expression, which in turn induces tbx5 expression. Tbx5 is a key molecule that regulates the expression of downstream effectors such as the fgf and bmp family members fgf24, fgf10, and bmp2b.7, 16 Thus, limb induction requires a sequential RA Wnt Tbx Fgf + Bmp signaling cascade. A parallel situation may exist for liver specification in medaka.

05). CD107a has relationship with viral load and HBeAg status.In vitro blockade NKP46, spontaneous cytolytic activity of NK cells against K562 cell lines and HepG2, HepG2.215 cell lines was decreased(p<0.05). Conlusion: NKP46 as a major activitory receptor has an obvious effect on the cytolytic function of

NK cells.NKP46 may be involved in both the suppression of HBV replication and HBV-associated liver damage underpinning the role of NK cells in the immunopathogenesis of chronic HBV infection. NKP46 was decreased significantly in high alanine aminotrans-ferases,high viral load and HBeAg positive group(a.b.c.d)The groups were divided by ALT,AST,HBV DNA and HBeAg status. Disclosures: The following people have nothing to disclose: Selleck RG7204 Wanyu

Li, Yanfang Jiang, Yanjun Cai, Yue Qi, Jinglan Jin, Xiaomei Wang, Junqi Niu To clarify the role of soluble CD40 (sCD40) in chronic hepatitis B (CHB), we measured the levels of sCD40 in sera from 132 CHB patients and 33 healthy individuals, and analyzed its association with serum levels of alanine transaminase (ALT) and aspartate transaminase (AST), and liver histological characteristics. The results indicated that sCD40 concentrations in CHB patients were significantly higher than in healthy controls (82.8 pg/ml vs 32.8 pg/ml). The sCD40 level was related to serum levels of ALT (r=0.487, p<0.001) and AST (r=0.492, p<0.001), and the intrahepatic Ishak necroinflammatory score (r=0.506, p<0.001) and fibrosis score 上海皓元 (r=0.395, p<0.001). MG-132 mouse CHB patients were distributed into four groups based on their Ishak necroinflammatory grading scores: minimal inflammation (scores 1-4), mild inflammation (score 5-8), moderate inflammation (score 9-12), and marked inflammation (score 13-18), which the mean of

sCD40 concentration was 61.8 pg/ml, 91.7 pg/ml, 139.0 pg/ml and 203.2 pg/ml respectively. The sCD40 concentration in CHB patients with minimal inflammation was significantly lower than that in patients with mild, moderate, and marked inflammation (p<0.01), and sCD40 concentration in CHB patients with mild inflammation was significantly lower than that in patients with moderate and marked inflammation (p<0.05). CHB patients with different fibrosis staging scores were distributed into four groups: normal (score 0), portal fibrotic expansion (score1 -2), bridging fibrosis (score3-4) and cirrhosis (score 5-6), which the mean of sCD40 concentration was 59.0 pg/ml, 66.1 pg/ml, 96.2 pg/ml and 157.2 pg/ml respectively. The difference in sCD40 levels between CHB patients without fibrosis (normal group) and healthy controls was not significant (p>0.05), whereas other groups showed significantly higher sCD40 concentrations than did healthy controls (p<0.001). sCD40 concentration in CHB patients with portal fibrotic expansion was significantly lower than that in patients with bridging fibrosis or cirrhosis (p<0.

5 years.22 An increase in the annual Kinase Inhibitor Library research buy number of diagnoses was observed during the study period, but the reason for the increase is not clear. In this Korean study, IPMN was the most common pancreatic cystic neoplasm observed, being found in 41% of all pancreatic cystic neoplasms. A Japanese study focusing on patients with end-stage renal disease on hemodialysis showed that the prevalence of both pancreatic cystic lesions and IPMN was significantly higher in hemodialysis patients than in controls.2 One important issue of pancreatic cysts is the risk for malignancy. A study by Tada et al. showed that patients

with pancreatic cystic lesions had higher risk of pancreatic cancer, with a standardized incidence rate of 22.5, and that the cancer might develop in regions remote from the pre-existing cystic lesion.3 In summary, published studies on the prevalence of pancreatic cystic lesions from Asia are sparse, and the few that are

available in the literature have shown wide-ranging data; these reflect limitations in the current studies. First, most of these studies are retrospective studies in which there is the possibility selleck chemicals llc of underestimation of pancreatic cyst prevalence. Second, the diagnostic criteria for pancreatic cystic lesions varied among these studies. As highlighted previously, determining the exact diagnosis of the lesions is very important for determining the potential for malignancy, thus unified criteria are necessary. Some Asian studies medchemexpress used cytological or pathological confirmation, while other studies did not. This difference alone could result in the miscalculation of the prevalence of pancreatic cystic lesions, misdiagnosis of the lesion types, and inaccurate estimation of the malignant potential of these lesions. On top of the aforementioned limitations, there is

a lack of robust information about the change in incidence of pancreatic cystic lesions in the East. It is widely assumed that the incidence of these lesions has increased due to better awareness and increased use of cross-sectional imaging of the abdomen. However, due to the lack of systematic studies, there is no robust data on the true incidence of pancreatic cystic lesions and any change over the recent decades. If the incidence is indeed increasing, the possible risk factors leading to the increase should be ascertained. To overcome these limitations and to more accurately estimate and compare the prevalence of pancreatic cystic lesions and the risk of malignancy of these lesions in Asia, consensus on imaging, including EUS diagnostic criteria, and cytological/pathological diagnostic criteria, should first be established. This would provide a strong foundation for collaborative, multicenter, prospective studies of pancreatic cystic lesions across Asia. The ACE recently initiated a multinational registry to address some of these issues.

5 years.22 An increase in the annual PF-01367338 purchase number of diagnoses was observed during the study period, but the reason for the increase is not clear. In this Korean study, IPMN was the most common pancreatic cystic neoplasm observed, being found in 41% of all pancreatic cystic neoplasms. A Japanese study focusing on patients with end-stage renal disease on hemodialysis showed that the prevalence of both pancreatic cystic lesions and IPMN was significantly higher in hemodialysis patients than in controls.2 One important issue of pancreatic cysts is the risk for malignancy. A study by Tada et al. showed that patients

with pancreatic cystic lesions had higher risk of pancreatic cancer, with a standardized incidence rate of 22.5, and that the cancer might develop in regions remote from the pre-existing cystic lesion.3 In summary, published studies on the prevalence of pancreatic cystic lesions from Asia are sparse, and the few that are

available in the literature have shown wide-ranging data; these reflect limitations in the current studies. First, most of these studies are retrospective studies in which there is the possibility Selleck GDC-0068 of underestimation of pancreatic cyst prevalence. Second, the diagnostic criteria for pancreatic cystic lesions varied among these studies. As highlighted previously, determining the exact diagnosis of the lesions is very important for determining the potential for malignancy, thus unified criteria are necessary. Some Asian studies 上海皓元医药股份有限公司 used cytological or pathological confirmation, while other studies did not. This difference alone could result in the miscalculation of the prevalence of pancreatic cystic lesions, misdiagnosis of the lesion types, and inaccurate estimation of the malignant potential of these lesions. On top of the aforementioned limitations, there is

a lack of robust information about the change in incidence of pancreatic cystic lesions in the East. It is widely assumed that the incidence of these lesions has increased due to better awareness and increased use of cross-sectional imaging of the abdomen. However, due to the lack of systematic studies, there is no robust data on the true incidence of pancreatic cystic lesions and any change over the recent decades. If the incidence is indeed increasing, the possible risk factors leading to the increase should be ascertained. To overcome these limitations and to more accurately estimate and compare the prevalence of pancreatic cystic lesions and the risk of malignancy of these lesions in Asia, consensus on imaging, including EUS diagnostic criteria, and cytological/pathological diagnostic criteria, should first be established. This would provide a strong foundation for collaborative, multicenter, prospective studies of pancreatic cystic lesions across Asia. The ACE recently initiated a multinational registry to address some of these issues.

Plasmids encoding various topoIIα mutations were generated from Flag-TopoIIα (GeneCopoeia, Rockville, MD) by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Primers used to generate topoIIα mutations were as follows:

S1361A, 5′-TGCTAGTCCAC CTAAGACCAAAACTGCCCCAAAACTTAG-3′/5′-C TAAGTTTTGGGGCAGTTTTGGTCTTAGGTGGA CTAGCA-3′; S1365A, 5′-GAC-CAAAACTTCCCCA AAACTTGCTAACAAAGAACTGAAACCACAG-3′/5′-CTGTG-GTTTCAGTTCTTTGTTAGCAAGTT TTGGGGAAGTTTTGGTC-3′; E1368A, 5′-CCC CAAAACTTAGTAACAAAGCACTGAAACCACAGA AAAGTGT-3′/5′-ACAC-TTTTCTGTGGTTTCAGT GCTTTGTTACTAAGTTT-TGGGG-3′; S1393A, 5′-GGGC-AGTGTACCACTGTCTTCAGCCCCTCCT GCTAC-3′/5′-GTAGCAGGAGGGGCTGA-AGACAG TGGTACACTGCCC-3′; T1397A, 5′-CTTCAAGCC CTCCTGCTGCACATT-TCCCAGATGAA-3′/5′-TTC Poziotinib chemical structure ATCTGGGAAATGTGCAGCAGGAGGGCTTGAAG-3′. Female athymic nude mice (5-6 weeks of age) were obtained from Harlan Laboratories (Indianapolis, IN). All experimental procedures were done according to protocols approved by the Ohio State

University Institutional Laboratory Animal Care and Use Committee. Each mouse was injected subcutaneously with 1 × 106 PLC5 cells in 0.1 mL serum-free medium containing 50% Matrigel. Mice with established tumors (mean starting tumor volume, 223 ± 75 mm3)

were randomized to two groups (n = 5) that MCE公司 received the following Idasanutlin treatments daily by gavage (10 μL/g body weight) for 3 or 6 days: (1) methylcellulose/Tween 80 vehicle, and (2) AR42 at 25 mg/kg. At the study endpoint, tumors were snap-frozen and stored at −80°C for subsequent coimmunoprecipitation analysis. Pursuant to our finding that AR42 exhibits high in vivo efficacy against PLC5 tumor growth,6 we examined the effects of AR42 on various biomarkers pertinent to the aggressive phenotype of HCC, among which the concentration- and time-dependent suppression of topoIIα expression was noteworthy (Fig. 1A). As AR42 inhibited topoIIα expression at concentrations well below its median inhibitory concentration (IC50) of 0.72 μM in inhibiting cell viability,6 this down-regulation was not consequent to drug-induced cell death. This topoIIα repression was also noted with MS-275 and, to a lesser extent, vorinostat; however, at an order-of-magnitude higher concentration. This drug-induced suppression was topoIIα-selective because these HDAC inhibitors did not cause dramatic changes in topoIIβ expression.

1 We applaud the authors for applying bile duct cytology and FISH to a large cohort of patients with PSC to better characterize the long-term outcomes. The authors used Vysis UroVysion, a commercially available kit that was approved by the U.S. Food and Drug Administration in 2005 for use in the initial diagnosis of bladder cancer in patients with hematuria.2 This probe set has since been applied to detect chromosomal abnormalities in various body sites including the detection of malignancies in biliary strictures.1, 3-7 The UroVysion kit allows for the simultaneous testing of numeric aberrations, or aneusomy, of chromosome 3 (CEP3),

chromosome 7 (CEP7), and chromosome 17 (CEP17), as well as band 9p21 (P16/CDKN2A) deletions.

Unfortunately, the authors provide no information on the results of CEP17 and p16 abnormalities in their cohort. We view the omission of Selleck EPZ6438 the CEP17 and p16 results as a potential lost opportunity. In histology specimens, p16 inactivation has been shown to be common in PSC-associated cholangiocarcinoma (CCA) with 90% showing the loss of one allele which correlated with the loss of p16 expression in 57% of CCAs.8 PD332991 Functional point mutations in the p16 promoter likely contribute to the initiation and progression of PSC-associated CCA.9 Using FISH, it was reported that four of six PSC-associated CCAs had CEP3, CEP7, and CEP17 aneusomy.5 The two CCAs that did not have aneusomy had p16 deletions.5 In addition, 64% of CCAs had CEP17 aneusomy, compared to 82% and 77% with aneusomy of CEP3 and CEP7, respectively.5 MCE It appears that CEP17 aneusomy and p16

deletions may be more common in PSC-associated CCA than the authors report. Since 2008, our liver program has adopted the use of FISH in addition to cytology in the diagnosis of indeterminate strictures and PSC-associated dominant strictures (n = 56). In our initial series, 12 tissue-proven CCAs were identified, of which 9 had nondiagnostic cytology.10 As reported previously, CEP3 and CEP7 aneusomy were most commonly seen in CCA (7 of 12 CCAs). Among CCA cases with positive FISH and negative cytology, we found that CEP17 aneusomy was present in 75% and p16 deletions were seen in 50%. Among the cases that had a p16 deletion (homozygous or heterozygous), nearly half of the cases (5 of 9) had no other chromosomal changes. Based on our experience and previously published data, we believe that the inclusion of CEP17 and p16 status may have significant additional diagnostic importance. After reviewing their published data, we agree with the author’s conclusion that FISH is inadequate to be used as a CCA screening modality in unselected patients with PSC, but may have a role in patients with a clinical or laboratory suspicion for PSC-associated dominant strictures. However, we question if their conclusion would have changed with the inclusion of CEP17 aneusomy and/or p16 deletions.