Trace intensity (Int mm) of ripA was normalized to the mean tul4 expression [23]. Mean normalized expression and standard deviation were calculated based on RT-PCR of four samples of RNA derived from independent cultures.

Significance was determined using an unpaired two tailed t test with unequal variance. Agarose formaldehyde electrophoresis and Northern analysis Total RNA was harvested from mid exponential phase F. tularensis LVS grown in Chamberlains defined media using RNAeasy columns (Qiagen), concentrated by ethanol/sodium acetate precipitation and quantified with a ND-1000 spectrophotometer (Nanodrop). RNA was separated using agarose-formaldehyde (2% agarose, 2.2 M Formaldehyde) electrophoresis followed by capillary transfer to nitrocellulose as described [45]. Additional lanes of the membrane containing Selleck MDV3100 duplicate samples were stained with methylene blue to assess rRNA bands for degradation and equality of loading. Digoxigenin labeled RNA probes were

generated using a Northern Starter Kit (Roche). Probe generation, hybridization, washing, and detection were performed using the manufacturer’s www.selleckchem.com/products/INCB18424.html (Roche) protocols. Reporter CHIR98014 clinical trial fusion construction and mutagenesis Specific F. tularensis LVS DNA fragments were produced by PCR amplification of genomic DNA using Pfu turbo DNA polymerase (Stratagene). Three DNA fragments were PCR amplified, cloned, and the DNA sequenced for conformity to the published F. tularensis LVS DNA sequence. (1) 1300 bp amplicon (primers TTTGGTGTGTTTATCGGTCTTGAAGGCGGTATTGATG and CACGATATCCATTTTATTCCTTTCTAATCCATTTATCC) for the generation of the in-frame ripA’-lacZ1 translational fusion of the ripA start codon to lacZ [46]. (2) 1000 bp amplicon (primers atagcggccgccaggtaaagtgactaaagtacaagataatggtgc and gcgttaattaacctttctaatccatttatccaaaagaatttacac) for the generation of the ripA’-lacZ2

transcriptional fusion. (3) 740 bp amplicon (primers agttGCGGCCGCtattccaaccagtgcatttttcactttagtg Gemcitabine manufacturer and TTCCttaattaaCTTATTGTCCTTTTTTTCACAACACCTTATAAGC) for the generation of the iglA’-lacZ transcriptional fusion. The lacZ reporter vectors pALH109 and pALH122 were used as the source of the translational and gene transcriptional lacZ fusion constructs [46]. The translational gene fusion (pALH109) was ligated with a pBSK vector containing the cat gene driven by the F. tularensis groEL promoter to construct pBSK lacZ cat. The transcriptional gene fusion (pALH122) was ligated with a pBSK vector containing the aphA1 allele driven by the F. tularensis groEL promoter to construct pBSK lacZ aphA1. A KpnI/EcoRV fragment containing the ripA promoter was ligated to a SmaI/KpnI fragment of pBSK lacZ cat to form pBSK ripA’-lacZ1. NotI/PacI fragments of the cloned promoters were ligated to a NotI/PacI fragment of pBSK lacZ aphA1 to form pBSK ripA’-lacZ2 and pBSK iglA’-lacZ.