Second, the sequence of MinC is less conserved than that of MinD in bacteria (data not shown). MinC could be too divergent to be recognized by sequence in higher plants. It is hard to understand why AtMinD is localized to static puncta in chloroplasts in previous study [20] instead of a dynamic oscillating pattern. Here we show that AtMinD is Selleckchem PU-H71 localized to puncta

at the polar regions in E. coli cells (Figure 2D and 2E) and puncta in chloroplasts (Figure 2A). By interacting with either endogenous or transiently expressed AtMinD, EcMinC-GFP, EcMinC-YFPN and EcMinC-YFPC are localized to puncta in chloroplasts too. These data further suggest that the punctate localization pattern of AtMinD in chloroplasts shown before [20, 24] may be true. There are usually only one or two GFP-labeled puncta in one chloroplast. It is possible that chloroplasts constrict in-between puncta. However, this hasn’t been confirmed. So far, it seems that the working

mechanism of Min system in plastids is a lot different from that in E. coli. However, the study of Min system in plastids is limited and our understanding about it is not very clear. AtMinE seems to have an antagonistic role to AtMinD in plastid, because the chloroplast division phenotype caused by overexpression of AtMinE was similar to that caused by antisense suppression of AtMinD in Arabidopsis [17, 19]. This kind of relationship is still similar to that of EcMinE and EcMinD [7]. Further study needs to be done to understand the working mechanism of AtMinE in plastids. Conclusion In this paper, we have shown that AtMinD was localized to puncta at the polar region learn more and is functional in E. coli. AtMinD may function through the interaction with EcMinC. It is not necessary for AtMinD to oscillate check to keep the cell division site at the center of E. coli cells. In Bacillus subtilis, the MinCD proteins are localized to polar regions without oscillation [27]. There is no MinE in B. subtilis [27]. Instead, another protein DivIVA tethers MinCD to poles of the cell and prevents FtsZ polymerization and division apparatus assembly at the end of the cells [27]. AtMinD and EcMinC in E. coli HL1 mutant (ΔMinDE)

may work in a manner similar to the BsMinD and BsMinC in Bacillus subtilis. Methods E. coli strains and bacterial expression vector construction The E. coli strains used in this study were DH5α, HL1 (ΔMinDE) [21] and RC1 (ΔMinCDE) [28]. The culture were grown to OD600 = 0.4 – 0.45 at 37°C in LB medium with 100 μg/ml ampicillin, 50 μg/ml kanamycin or 25 μg/ml chloramphenicol respectively as required. AtMinD lacking the coding region of the N-terminal 57 amino acid residues were amplified by using primers: AD1F1, CGGAATTCAACAAGGAATTTCTATGCCGGAACTCGCCGGAGAAACGC and AD1R1, GCAAGCTTTTAGCCGCCAAAGAAAGAGAAGA. EcMinD and EcMinDE were amplified from the see more genomic DNA of DH5α by primers: EcDF1, GCGGAATTCAAGGAATTTCTATGGCACG and EcDR1, GCGAAGCTTATCCTCCGAACAAGCG or EcER1, GCGAAGCTTA CAGCGGGCTTATTTCAG.