All DNA samples were stored at −20°C. Whole genome amplification was performed using LA Taq (Takara, Osaka, Japan) according to the method described by Günther

et al., with the primers for P1(1821 to 1841), CCGGAAAGCTTGAGCTCTTCTTTTTCACCTCTGCCTAATCA,  and  P2  (1823 to 1806),  CCGGAAAGCTTGAGCTCTTCAAAAAGTTGCATGGTGCTGG [34]. The lowest DNA amount required for amplification was 103 copies/ml in our experimental system. Sequencing primers are listed in Additional file 1: Table S1, and the primers SP5 and SP9 were also used for buy Ibrutinib preS region amplification. Hot start PCR for the preS region was performed with the following cycle: 95°C for 2 minutes and 30 seconds, followed by 35 cycles of denaturation at 94°C for 1 minute, annealing at 58°C for 90 seconds, and elongation at 72°C for 3 minutes. All reactions were performed on a PTC-200 Peltier Thermal Cycler (MJ Research, MA, USA). Viral DNA sequencing After purification via the Montage PCR96 column (Millipore, MA, USA), PCR products were sequenced on a Prism 3730 (ABI, USA). Contigs were assembled using SeqMan (DNAstar 5.0, WI, USA), and sequences were aligned using ClustalW for further analysis. All mutations were checked manually. Whole genomes mentioned in this study are defined as >97% of full length and

sequencing gaps at the end of the genome have no overlaps with deletion hotspots. The boundaries of deletion regions that appeared in the sequencing electropherogram were determined by reading from both directions. The regions www.selleckchem.com/products/Deforolimus.html of interest were amplified by PCR and the products were cloned into a pMD18 T vector (Takara, Osaka, Japan) followed by sequencing of 5–10 positive clones per sample. NCBI accession numbers for all sequences are listed in Additional file 1: Table S2. Construction of HBV mutants

and examination of their antiviral resistance Candidate deletions were introduced into the HBV-expression plasmid Yi026-pcDNA3.1/Zeo(−) using the QuikChange® Site-Directed Mutagenesis Kit (Stratagene, CA, USA). The plasmid, harboring a 1.1X overlength BCKDHB genome of HBV (ayw), was kindly provided by Yi Ni and Stephan Urban from the University of Heidelberg (Heidelberg, Germany). Introduced mutations were verified by plasmid re-sequencing. HuH7 cells were seeded into 10 cm2 dishes at 1.5 × 106 cells/dish, reaching around 90% confluency before transfection the following day. Cells were transfected using 24 μl FuGENE®HD (Roche, IN, USA)) reagent with 8 μg of plasmid DNA. 16–20 h post-transfection, transfected cells were washed twice and then seeded into a 96-well plate at 3 × 104 cells/well. The cells were treated with serial dilutions of four drugs in fresh medium for 3 days, including lamivudine (LMV), adefovir (ADV), entecavir and tenofovir (Sequoia Research Products Limited, UK).